An Introduction to Genetic Genealogy

This page provides an introduction to some of the ideas behind genetic genealogy and ancestry testing. Please see Links for other websites with more information on these topics. If you have any questions please don't hesitate to contact us!

What is DNA?
What are genetic markers?
What is the Y chromosome?
What are Y-SNPs?
What are Y-STRs?
What is a haplotype?
What is a haplogroup?

DNA

DNA is the complex chemical in which the instructions to build and run our bodies are written – this genetic code is the ‘blueprint’ for life. It is also the means of transmitting this information to the next generation. The code is written in four letters, A, C, G or T, which are in reality different chemicals making up the larger molecule. We each carry a enormous number of DNA letters (3000 billion) – all of which we have inherited from our ancestors – it is an archive of our ancestry.

Markers

All these letters have to be copied for the new generation when sperm and eggs are made and sometimes a mistake is made, a T is entered instead of an A for instance. This change in the DNA code will be inherited by the descendants of the person in which it occurred and is what is called a marker, in this case a SNP marker. The vast majority of our DNA has no known function is just being carried as ‘junk’ and it is here that the DNA markers we use are located, they have no known function.

Y chromosome

DNA is organised into 23 huge strings called chromosomes. We each carry two copies of each of our chromosomes, one from our father and one from our mother, except for a special chromosome called the Y chromosome. This is because the Y chromosome’s function is to determine that a baby is a boy, so it is only inherited from the father to the son. Women do not carry a Y chromosome. The Y chromosome is a very useful piece of DNA as a huge number of markers are known on the Y chromosome. Adding all of them together makes it a very powerful for identifying ancestral lineages, from recent times to tens of thousands of years ago. There are around 30 million unique letters on the Y chromosome and so there are many more markers to be found.

YSNPs

One of the two major kinds of markers is called SNP (pronounced ‘snip’). The A to T letter change mentioned above is an example of a SNP, one letter in the code is replaced by another. This is a stable change. YSNPs are SNPs on the Y chromosome so are passed from father to son to grandson down the generations. SNPs occur somewhat infrequently and so males who share a SNP typically share an ancestor who lived hundreds of generations ago in ‘deep ancestral’ time. The SNP tests use a technique to ‘look’ to see which letter a customer carries in his DNA at a certain marker.

YSTRs

The other major kind of marker is called STR. There are places in our DNA where a small number of letters will be repeated in a row, such as CACACACACACACACA (this would be a 'CA' repeat) or GATAGATAGATAGATAGATA (this would be a 'GATA' repeat).

When all the DNA is being copied to make sperm and eggs, sometimes the copying machinery loses track of the number of repeats of for example GATA or CA in the sequences mentioned above and adds in or takes away one. So if the father has 14 copies of GATA, normally all his sons and grandsons would have the same, but from time to time one would get 13 or perhaps 15 copies of GATA. These changes are also inherited down the generations, and if they take place on the Y chromosome are inherited down the male line. These occur much more commonly than SNPs, and so can be used to look at more recent events, in a historical time frame, as well as deeper ancestry. The YSTR tests use a technique to ‘look’ to see how many copies of GATA or CA a customer carries in his DNA at a certain marker.

Haplotype

When you are tested for a number of STR markers you will receive your results in the form of the counts of the GATA or CA repeats – eg 12-13-13-14-24-11. This means you have 12 repeats at the first marker, 13 at the next and so on. This is your genetic type or haplotype – your DNA signature. It describes your paternal lineage and will be shared by your close male line relatives, except in cases where a change has occurred. More distant male line relative will differ at a few markers in the haplotype, while unrelated people will be very different. It is necessary to compare at least 20 markers to be sure if you are related or not.

Haplogroup

A haplogroup is a group of related haplotypes. In practice haplogroups are defined by the more slowly changing SNP markers. There are a number of different haplogroups which can be found in each population, some are specific to a certain part of the world, others are more widespread. There are different frequencies of each haplogroup in each population. Knowing which haplogroup (or subgroup) you belong to allows you to further explore your genetic history. Haplogroups are designated by letter, from A through to R, with suffices to represent subgroups, eg R1b1 or I1b1. The haplogroups are related to each other through the global Y chromosome tree, an outline of which is shown below. The International Society of Genetic Genealogists hosts the most up to date and detailed version of this tree.

The global Y chromosome tree

The distribution of major Y chromosome haplogroups

Any question? Please don't hesitate to contact us!